Introduction to Bioinformatics

Lesson 1 of 16 · 10 min

What is bioinformatics?

Bioinformatics is the practice of using computers and statistics to make sense of biological data, which is the huge collection of letters and numbers that comes out of studying living things. If that sounds intimidating, relax: by the end of this short lesson you'll have a clear, plain-English picture of what the field is and why so many people are excited about it.

Bioinformatics sits at the crossroads of three subjects: biology (the study of living things), computer science (getting computers to store and process information), and statistics (finding real patterns in data and telling them apart from random noise). You don't need to be an expert in any of them today. You just need to be curious.

The data deluge

Modern machines called sequencers read the DNA (the molecule inside every cell that carries an organism's instructions) and write it down as a long string made of the letters A, C, G, and T, where each letter stands for one chemical building block called a nucleotide. A single machine can produce billions of these letters in a single day, far more than any human could ever read or count by hand. That flood of data is exactly why bioinformatics exists: we hand the reading, counting, and pattern-finding to computers, then use statistics to decide which patterns truly mean something.

Where you'll see it

When health agencies track new variants of the COVID or flu virus, they are doing bioinformatics: they compare the sequences of many virus samples to spot the tiny letter changes that define a new variant. The same kinds of tools help scientists discover new drugs by searching for molecules likely to act on a disease-causing target.

Bioinformatics also powers precision medicine, where a patient's own DNA helps doctors choose the treatment most likely to work for that specific person. It lets researchers build evolutionary trees that show how different species are related, and assemble genomes (the complete set of DNA instructions for an organism) by piecing millions of short DNA fragments back together.

This course assumes no biology and no coding background whatsoever. Every term is explained the first time it appears, and every command is something you can copy, run, and understand step by step. If you've never opened a terminal (the text window where you type commands to a computer) or seen a line of code, you are exactly who this course is written for.

A peek at real data

text
>my_first_sequence
ATGGCTAGCAAAGGTGAAGAACTGTTT

That little block is a real data format called FASTA: the line starting with a greater-than sign gives the sequence a name, and the line below it is the sequence itself. Over the next 16 lessons you'll learn to fetch sequences like this from public databases, inspect and count what's inside them, run simple analyses on them, and use a tool called BLAST to find out which known organisms or genes a mystery sequence matches.

Try it yourself: Look at the sequence in the block above and count how many times the letter A appears among its 27 letters. It is tedious even for a short sequence like this one, so now imagine a sequence with three billion letters. That feeling is the whole reason we teach computers to do the counting for us.